ID: 1195444032_1195444034

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1195444032 1195444034
Species Human (GRCh38) Human (GRCh38)
Location X:104930420-104930442 X:104930447-104930469
Sequence CCATTATTGCAATATTATAAACA CTGAGTGCTCACTATGTGATAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 22, 3: 201, 4: 1022}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!