ID: 1195460255_1195460262

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1195460255 1195460262
Species Human (GRCh38) Human (GRCh38)
Location X:105115890-105115912 X:105115925-105115947
Sequence CCTGCCCCGCAGAGAGGCAGCTA AAATCAAGCACAGCAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 44, 2: 235, 3: 701, 4: 819} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!