ID: 1195470133_1195470142

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1195470133 1195470142
Species Human (GRCh38) Human (GRCh38)
Location X:105220707-105220729 X:105220755-105220777
Sequence CCAACGTCGGCTTTTACTCTGGG GGAGTGGAAGGGAGTGAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 14, 3: 154, 4: 1684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!