ID: 1195489469_1195489481

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1195489469 1195489481
Species Human (GRCh38) Human (GRCh38)
Location X:105450215-105450237 X:105450237-105450259
Sequence CCCCAAGTCACTGCACTCGCCCT TCTGGGAGATGGGGGAGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 15, 3: 113, 4: 987}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!