ID: 1195502124_1195502132

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1195502124 1195502132
Species Human (GRCh38) Human (GRCh38)
Location X:105613636-105613658 X:105613664-105613686
Sequence CCATCCACCACAAGCTCATTAAA CTCGGGCCTTAAGGGAACATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 192} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!