ID: 1195506225_1195506230

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1195506225 1195506230
Species Human (GRCh38) Human (GRCh38)
Location X:105659870-105659892 X:105659908-105659930
Sequence CCTGCAAGATGTAGAAAATATCC AAGACTTATTGGCCCTAAAGAGG
Strand - +
Off-target summary No data {0: 2, 1: 11, 2: 274, 3: 470, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!