ID: 1195508020_1195508030

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195508020 1195508030
Species Human (GRCh38) Human (GRCh38)
Location X:105681202-105681224 X:105681248-105681270
Sequence CCTCTTTGGAGAAGAGGAATTCT GAGAACAAGGAGGAGGAGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 163, 4: 1410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!