ID: 1195554887_1195554895 |
View in Genome Browser |
Spacer: 10 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1195554887 | 1195554895 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:106210600-106210622 | X:106210633-106210655 |
| Sequence | CCAGCACTGCACACCTCATGGGG | GCACACAGCACGGAGACCCTGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 7, 1: 88, 2: 526, 3: 804, 4: 885} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||