ID: 1195558715_1195558723

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1195558715 1195558723
Species Human (GRCh38) Human (GRCh38)
Location X:106258092-106258114 X:106258141-106258163
Sequence CCTCTTTTACTCCAAACCATGGA CTAGAATAGCGAAGGCCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 34, 3: 65, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!