ID: 1195558717_1195558720

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1195558717 1195558720
Species Human (GRCh38) Human (GRCh38)
Location X:106258103-106258125 X:106258133-106258155
Sequence CCAAACCATGGAAAAAGGACCTA ATGCCCGTCTAGAATAGCGAAGG
Strand - +
Off-target summary {0: 14, 1: 15, 2: 18, 3: 7, 4: 111} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!