ID: 1195584602_1195584607

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1195584602 1195584607
Species Human (GRCh38) Human (GRCh38)
Location X:106551389-106551411 X:106551425-106551447
Sequence CCGACCACCACTGCTGTTTGCTG GCCGCTGACTTCCATCCCTCTGG
Strand - +
Off-target summary {0: 2, 1: 31, 2: 89, 3: 138, 4: 303} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!