ID: 1195611315_1195611319

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1195611315 1195611319
Species Human (GRCh38) Human (GRCh38)
Location X:106870488-106870510 X:106870515-106870537
Sequence CCTAGTTCCCAACTTTCCTAAAG CGTTTTAGTCTAAACAGAAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!