ID: 1195619359_1195619367

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1195619359 1195619367
Species Human (GRCh38) Human (GRCh38)
Location X:106937664-106937686 X:106937699-106937721
Sequence CCTCCTAGATCCCTGGTACTAGG ATACAGTGGTTGGCAAAAACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!