ID: 1195623477_1195623479

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195623477 1195623479
Species Human (GRCh38) Human (GRCh38)
Location X:106983091-106983113 X:106983137-106983159
Sequence CCTTTGAGTTGTCATGTCTGTGC CACTTCCGATTTTAGATTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 25, 3: 234, 4: 740}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!