ID: 1195654745_1195654754

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1195654745 1195654754
Species Human (GRCh38) Human (GRCh38)
Location X:107323898-107323920 X:107323938-107323960
Sequence CCGAGGCGGAGCTGGGCCCAGGG ATGGAGCACGAGAGGCAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!