ID: 1195668349_1195668361

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1195668349 1195668361
Species Human (GRCh38) Human (GRCh38)
Location X:107449915-107449937 X:107449944-107449966
Sequence CCGCCGCTGCGCCGCCGCTGCCG TGAGGAGGCGGAGGAGGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 105, 4: 517} {0: 2, 1: 100, 2: 2978, 3: 8239, 4: 16833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!