ID: 1195668349_1195668365

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1195668349 1195668365
Species Human (GRCh38) Human (GRCh38)
Location X:107449915-107449937 X:107449959-107449981
Sequence CCGCCGCTGCGCCGCCGCTGCCG GGAGGAGGAGGAGGAGGAAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 105, 4: 517} {0: 236, 1: 3079, 2: 7171, 3: 14263, 4: 24048}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!