ID: 1195687992_1195687996

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1195687992 1195687996
Species Human (GRCh38) Human (GRCh38)
Location X:107602709-107602731 X:107602731-107602753
Sequence CCTCCCGCACTCAGGAGATTGAC CCTCCGTGTGTCCACCTTCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 118} {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!