ID: 1195709309_1195709312

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1195709309 1195709312
Species Human (GRCh38) Human (GRCh38)
Location X:107761283-107761305 X:107761299-107761321
Sequence CCCACAAGGGCTAGAACTTCCTG CTTCCTGCCCCTCTGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!