ID: 1195729257_1195729268

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1195729257 1195729268
Species Human (GRCh38) Human (GRCh38)
Location X:107949237-107949259 X:107949273-107949295
Sequence CCTACTCAAGCCTCAGCTATGGC CCTGCCAGGCTGCTGCCTCACGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 9, 3: 81, 4: 571}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!