|
Left Crispr |
Right Crispr |
| Crispr ID |
1195758344 |
1195758349 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:108221056-108221078
|
X:108221104-108221126
|
| Sequence |
CCATTGTACTCCAGCCTGGGCAA |
AAAAATGCAGAAATGCAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2312, 1: 45463, 2: 120001, 3: 189875, 4: 216689} |
{0: 1, 1: 0, 2: 11, 3: 218, 4: 4927} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|