ID: 1195808668_1195808675

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1195808668 1195808675
Species Human (GRCh38) Human (GRCh38)
Location X:108804339-108804361 X:108804382-108804404
Sequence CCAAAAAAAGTCCAGGTCCAGAC CCATTGGCACAAAGAGGAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 80, 3: 2524, 4: 4480}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!