|
Left Crispr |
Right Crispr |
Crispr ID |
1195810708 |
1195810720 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
X:108825504-108825526
|
X:108825550-108825572
|
Sequence |
CCACCCTGCTTCTGCTTGCCCTC |
CCAGTCCCAATGAAATGAACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} |
{0: 4, 1: 175, 2: 425, 3: 370, 4: 317} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|