ID: 1195810708_1195810720

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195810708 1195810720
Species Human (GRCh38) Human (GRCh38)
Location X:108825504-108825526 X:108825550-108825572
Sequence CCACCCTGCTTCTGCTTGCCCTC CCAGTCCCAATGAAATGAACTGG
Strand - +
Off-target summary {0: 67, 1: 274, 2: 555, 3: 796, 4: 1307} {0: 4, 1: 175, 2: 425, 3: 370, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!