ID: 1195831662_1195831664

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1195831662 1195831664
Species Human (GRCh38) Human (GRCh38)
Location X:109066099-109066121 X:109066124-109066146
Sequence CCATGCAGTATTTGTCTTTCTAT CTGGCTTATTTCACTTATCATGG
Strand - +
Off-target summary {0: 4, 1: 20, 2: 72, 3: 233, 4: 724} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!