ID: 1195846522_1195846535

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1195846522 1195846535
Species Human (GRCh38) Human (GRCh38)
Location X:109234999-109235021 X:109235045-109235067
Sequence CCCAAACACCTCCCACCAGACCC ATTCAACATGAGATTTGAGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!