ID: 1195850341_1195850343

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1195850341 1195850343
Species Human (GRCh38) Human (GRCh38)
Location X:109275977-109275999 X:109275990-109276012
Sequence CCAACAGTCTCTTGGGTCCTAAG GGGTCCTAAGGAACACCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!