ID: 1195878622_1195878624

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1195878622 1195878624
Species Human (GRCh38) Human (GRCh38)
Location X:109569369-109569391 X:109569399-109569421
Sequence CCAGATGTATTAAAAATATATAA TTAAATAAGCATATAGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 29, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!