ID: 1195906947_1195906950

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1195906947 1195906950
Species Human (GRCh38) Human (GRCh38)
Location X:109853415-109853437 X:109853452-109853474
Sequence CCTTCAGGATTACATTGCAGTGA AAGTACCTGCCTCACAGCATAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 3, 3: 15, 4: 154} {0: 1, 1: 0, 2: 2, 3: 20, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!