ID: 1195926117_1195926119

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1195926117 1195926119
Species Human (GRCh38) Human (GRCh38)
Location X:110026491-110026513 X:110026514-110026536
Sequence CCTGGAGATGTATTGGAGTCCAA TAGTTAGAACCTCAGAGCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!