ID: 1195927256_1195927262

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1195927256 1195927262
Species Human (GRCh38) Human (GRCh38)
Location X:110038412-110038434 X:110038445-110038467
Sequence CCATGCCCACTTTGGCTCAGGGA CTGAGGAACAGCCTCCCTTTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!