ID: 1195941741_1195941748

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1195941741 1195941748
Species Human (GRCh38) Human (GRCh38)
Location X:110173092-110173114 X:110173113-110173135
Sequence CCGAGGGGAGAGAAGAAATCCCT CTTTATAAACAGGTGGGGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 248} {0: 1, 1: 0, 2: 0, 3: 17, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!