ID: 1195957429_1195957432

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1195957429 1195957432
Species Human (GRCh38) Human (GRCh38)
Location X:110346852-110346874 X:110346874-110346896
Sequence CCAGCTGGAGCTGTTGAACCACT TTTCTTCGTAGCGGCGACGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 113} {0: 1, 1: 1, 2: 2, 3: 0, 4: 5}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!