ID: 1195968651_1195968661

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1195968651 1195968661
Species Human (GRCh38) Human (GRCh38)
Location X:110451676-110451698 X:110451706-110451728
Sequence CCTACCCTCTGGAGTGATGCCCA GATGCCAGCCCCAGGCTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137} {0: 1, 1: 0, 2: 5, 3: 41, 4: 453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!