ID: 1195969622_1195969626

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1195969622 1195969626
Species Human (GRCh38) Human (GRCh38)
Location X:110459057-110459079 X:110459083-110459105
Sequence CCTTGTGGGTTCAAGTGATTCTG CCTCAGCTTCCCGAGTAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 69, 2: 1931, 3: 31052, 4: 81116} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!