ID: 1195969622_1195969627 |
View in Genome Browser |
Spacer: 11 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1195969622 | 1195969627 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:110459057-110459079 | X:110459091-110459113 |
| Sequence | CCTTGTGGGTTCAAGTGATTCTG | TCCCGAGTAGCTGGGATTACAGG |
| Strand | - | + |
| Off-target summary | No data | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||