ID: 1195993148_1195993155

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1195993148 1195993155
Species Human (GRCh38) Human (GRCh38)
Location X:110703194-110703216 X:110703215-110703237
Sequence CCTGGGTTTTGACAAGCCTTCCA CAGGGGATTCTGATGGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 53, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!