ID: 1196003303_1196003307

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1196003303 1196003307
Species Human (GRCh38) Human (GRCh38)
Location X:110809133-110809155 X:110809157-110809179
Sequence CCAGTCCCACAGGATCAGTCTCC TCTGAGTTCCCTAAACTAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!