ID: 1196010404_1196010410

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1196010404 1196010410
Species Human (GRCh38) Human (GRCh38)
Location X:110880913-110880935 X:110880957-110880979
Sequence CCTGTGACTGGAGCTGTGACACC TGTGTGCACACCCATGCCCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 26, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!