ID: 1196031582_1196031588

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1196031582 1196031588
Species Human (GRCh38) Human (GRCh38)
Location X:111098950-111098972 X:111098991-111099013
Sequence CCTCTGCAGGGCCTGGAATGGAC CTACACAGCTTCTCCAGCAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 26, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!