ID: 1196044851_1196044859

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1196044851 1196044859
Species Human (GRCh38) Human (GRCh38)
Location X:111246370-111246392 X:111246415-111246437
Sequence CCCATGTCCAGCTGCTGGAGGTA GCTACTTGGATTGGGAGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135} {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!