ID: 1196089754_1196089759

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1196089754 1196089759
Species Human (GRCh38) Human (GRCh38)
Location X:111726917-111726939 X:111726958-111726980
Sequence CCAGGCTGCAGCACAGTATGCAT ATGCACTACTCACAGACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 173} {0: 1, 1: 0, 2: 0, 3: 14, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!