ID: 1196116609_1196116624

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1196116609 1196116624
Species Human (GRCh38) Human (GRCh38)
Location X:112005923-112005945 X:112005959-112005981
Sequence CCGACCATGGGTTCCCAGGAGAA GCAGGGGGAAGGTGGCGGCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 62, 4: 764}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!