ID: 1196234842_1196234846

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1196234842 1196234846
Species Human (GRCh38) Human (GRCh38)
Location X:113267140-113267162 X:113267168-113267190
Sequence CCACCTCATTACTGCAACCATTC CTAGTTCTGCCGCTCACTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!