ID: 1196262742_1196262744

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1196262742 1196262744
Species Human (GRCh38) Human (GRCh38)
Location X:113603849-113603871 X:113603883-113603905
Sequence CCTGTTCTGAGTACACAGTTAAC GCTTAAGCATGTGCATCTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 16, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!