ID: 1196326097_1196326104

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1196326097 1196326104
Species Human (GRCh38) Human (GRCh38)
Location X:114404949-114404971 X:114404980-114405002
Sequence CCAAGCAACAGTGTTGGGAGGTG TGAGGGGTGTTTCATTCATGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 9, 3: 36, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!