ID: 1196385991_1196385998

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1196385991 1196385998
Species Human (GRCh38) Human (GRCh38)
Location X:115151838-115151860 X:115151882-115151904
Sequence CCCAGGAGAAAAAAACTAAGGCA CAGGAGACAGAGCTGGAGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 15, 3: 105, 4: 797}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!