ID: 1196388965_1196388971

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1196388965 1196388971
Species Human (GRCh38) Human (GRCh38)
Location X:115189940-115189962 X:115189963-115189985
Sequence CCGTCGAGCCTGGCTCACAGCGT TGGCTGTGGAATGCGCGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 1136} {0: 1, 1: 0, 2: 1, 3: 6, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!