ID: 1196388967_1196388972

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1196388967 1196388972
Species Human (GRCh38) Human (GRCh38)
Location X:115189948-115189970 X:115189978-115190000
Sequence CCTGGCTCACAGCGTTGGCTGTG CGGGAAGGCACCGACTGTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 175} {0: 1, 1: 0, 2: 0, 3: 1, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!