ID: 1196545708_1196545713

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1196545708 1196545713
Species Human (GRCh38) Human (GRCh38)
Location X:116962340-116962362 X:116962389-116962411
Sequence CCCAGTTTGAACTTCCTGGCTGC ACCTACTCAAGCCTCAGCAGTGG
Strand - +
Off-target summary No data {0: 37, 1: 1394, 2: 1634, 3: 1502, 4: 1414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!