ID: 1196566793_1196566796

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1196566793 1196566796
Species Human (GRCh38) Human (GRCh38)
Location X:117216324-117216346 X:117216353-117216375
Sequence CCACTTCAGACTGAGTAGCCATA CTGAGCAAAAATAATAAAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 119, 3: 1149, 4: 7640}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!